Excellence in Research and Innovation for Humanity

International Science Index

Commenced in January 1999 Frequency: Monthly Edition: International Paper Count: 36

Biological, Biomolecular, Agricultural, Food and Biotechnological Engineering

  • 2017
  • 2016
  • 2015
  • 2014
  • 2013
  • 2012
  • 2011
  • 2010
  • 2009
  • 2008
  • 2007
  • 36
    9998705
    Polymorphism of HMW-GS in Collection of Wheat Genotypes
    Abstract:

    Processes of plant breeding, testing and licensing of new varieties, patent protection in seed production, relations in trade and protection of copyright are dependent on identification, differentiation and characterization of plant genotypes. Therefore, we focused our research on utilization of wheat storage proteins as genetic markers suitable not only for differentiation of individual genotypes, but also for identification and characterization of their considerable properties. We analyzed a collection of 102 genotypes of bread wheat (Triticum aestivum L.), 41 genotypes of spelt wheat (Triticum spelta L.), and 35 genotypes of durum wheat (Triticum durum Desf.), in this study. Our results show, that genotypes of bread wheat and durum wheat were homogenous and single line, but spelt wheat genotypes were heterogenous. We observed variability of HMW-GS composition according to environmental factors and level of breeding and predict technological quality on the basis of Glu-score calculation.

    35
    9999389
    Consumption Habits of Low-Fat Plant Sterol-Enriched Yoghurt Enriched with Phytosterols
    Abstract:

    The increasing interest in plant sterol enriched foods is due to the fact that they reduce blood cholesterol concentrations without adverse side effects. In this context, enriched foods with phytosterols may be helpful in protecting population against atherosclerosis and cardiovascular diseases. The aim of the present work was to evaluate in a population of Viseu, Portugal, the consumption habits low-fat, plant sterol-enriched yoghurt. For this study, 577 inquiries were made and the sample was randomly selected for people shopping in various supermarkets. The preliminary results showed that the biggest consumers of these products were women aged 45 to 65 years old. Most of the people who claimed to buy these products consumed them once a day. Also, most of the consumers under antidyslipidemic therapeutics noticed positive effects on hypercholesterolemia.

    34
    9998704
    RAPD Analysis of Genetic Diversity of Castor Bean
    Abstract:

    The aim of this work was to detect genetic variability among the set of 40 castor genotypes using 8 RAPD markers. Amplification of genomic DNA of 40 genotypes, using RAPD analysis, yielded in 66 fragments, with an average of 8.25 polymorphic fragments per primer. Number of amplified fragments ranged from 3 to 13, with the size of amplicons ranging from 100 to 1200 bp. Values of the polymorphic information content (PIC) value ranged from 0.556 to 0.895 with an average of 0.784 and diversity index (DI) value ranged from 0.621 to 0.896 with an average of 0.798. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared and analyzed genotypes were grouped into two main clusters and only two genotypes could not be distinguished. Knowledge on the genetic diversity of castor can be used for future breeding programs for increased oil production for industrial uses.

    33
    9999157
    Dexamethasone: Impact on Testicular Activity
    Abstract:

    Dexamethasone (Dex) is a synthetic glucocorticoid that is used in therapy. However prolonged treatments with high doses are often required. This causes side effects that interfere with the activity of several endocrine systems, including the gonadotropic axis. The aim of our study is to determine the effect of Dex on testicular function in prepubertal Wistar rats. Newborn Wistar rats are submitted to intraperitoneal injection of Dex (1μg of Dex dissolved in NaCl 0.9% / 5g bw) for 20 days and then sacrificed at the age of 40days. A control group received NaCl 0.9%. The rat is weighed daily. The plasmatic levels of testosterone, LH and FSH were measured by radioimmunoassay. A histomorphometric study was performed on sections of testis. Treated groups showed a significant decrease in body weight (p < 0.05), testis weight (p < 0.05) and plasma levels of testosterone (p < 0.05), of LH (P < .05) and FSH (p> 0.05). There is a reduction of seminiferous tubules average diameter and also of the seminiferous epithelium thickness with an increasing of lumen tubular. The diameter of the Leydig cells and Sertoli cell nucleus is also significantly reduced. Spermatogenesis is blocked at the stage round spermatid unlike witnesses or elongated spermatid stage is found. These results suggest that Dex administered during neonatal life influences testicular activity in the long term.

    32
    9999387
    Antioxidant and Aِntimicrobial Properties of Peptides as Bioactive Components in Beef Burger
    Abstract:

    Dried soy protein hydrolysate powder was added to the burger in order to enhance the oxidative stability as well as decreases the microbial spoilage. The soybean bioactive compounds (soy protein hydrolysate) as antioxidant and antimicrobial were added at level of 1, 2 and 3 %.Chemical analysis and physical properties were affected by protein hydrolysate addition. The TBA values were significantly affected (P < 0.05) by the storage period and the level of soy protein hydrolysate. All the tested soybean protein hydrolysate additives showed strong antioxidant properties. Samples of soybean protein hydrolysate showed the lowest (P < 0.05) TBA values at each time of storage. The counts of all determined microbiological indicators were significantly (P < 0.05) affected by the addition of the soybean protein hydrolysate. Decreasing trends of different extent were also observed in samples of the treatments for total viable counts, Coliform, Staphylococcus aureus, yeast and molds. Storage period was being significantly (P < 0.05) affected on microbial counts in all samples Staphylococcus aureus were the most sensitive microbe followed by Coliform group of the sample containing protein hydrolysate, while molds and yeast count showed a decreasing trend but not significant (P < 0.05) until the end of the storage period compared with control sample. Sensory attributes were also performed, added protein hydrolysate exhibits beany flavor which was clear about samples of 3% protein hydrolysate.

    31
    9998916
    Physical, Textural and Sensory Properties of Noodles Supplemented with Tilapia Bone Flour (Tilapia nilotica)
    Abstract:

    Fishbone of Nile Tilapia (Tilapia nilotica), waste from the frozen Nile Tilapia fillet factory, is one of calcium sources. In order to increase fish bone powder value, this study aimed to investigate the effect of Tilapia bone flour (TBF) addition (5, 10, 15% by flour weight) on cooking quality, texture and sensory attributes of noodles. The results indicated that tensile strength, color value (a*) and water absorption of noodles significantly decreased (p£0.05) as the levels of TBF increased from 0-15%. While cooking loss, cooking time and color values (L* and b*) of noodles significantly increased (p£0.05). Sensory evaluation indicated that noodles with 5% TBF received the highest overall acceptability score.

    30
    9998913
    Effect on Physicochemical and Sensory Attributes of Bread Substituted with Different Levels of Matured Soursop (Anona muricata) Flour
    Abstract:

    Soursop (Anona muricata) is one of the underutilized tropical fruits containing nutrients, particularly dietary fibre and antioxidant properties that are beneficial to human health. This objective of this study is to investigate the feasibility of matured soursop pulp flour (SPF) to be substituted with high-protein wheat flour in bread. Bread formulation was substituted with different levels of SPF (0%, 5%, 10% and 15%). The effect on physicochemical properties and sensory attributes were evaluated. Higher substitution level of SPF resulted in significantly higher (p<0.05) fibre, protein and ash content, while fat and carbohydrate content reduced significantly (p<0.05). FESEM showed that the bread crumb surface of control and 5% SPF appeared to distribute evenly and coalesced by thin gluten film. However, higher SPF substitution level in bread formulation exhibited a deleterious effect by formation of discontinuous gluten network. For texture profile analysis, 5% SPF bread resulted in the lowest value of hardness. The score of sensory evaluation showed that 5% SPF bread received good acceptability and is comparable with control bread.

    29
    9998724
    Bird Diversity along Boat Touring Routes in Tha Ka Sub-District, Amphawa District, Samut Songkram Province, Thailand
    Abstract:

    This research aims to study species, abundance, status of birds, the similarities and activity characteristics of birds which reap benefits from the research area in boat touring routes in Tha Ka sub-district, Amphawa District, Samut Songkram Province, Thailand. from October 2012 – September 2013. The data was analyzed to find the abundance, and similarity index of the birds. The results from the survey of birds on all three routes found that there are 33 families and 63 species. Route 3 (traditional coconut sugar making kiln – resort) had the most species; 56 species. There were 18 species of commonly found birds with an abundance level of 5, which calculates to 28.57% of all bird species. In August, 46 species are found, being the greatest number of bird species benefiting from this route. As for the status of the birds, there are 51 resident birds, 7 resident and migratory birds, and 5 migratory birds. On Route 2 and Route 3, the similarity index value is equal to 0.881. The birds are classified by their activity characteristics i.e. insectivore, piscivore, granivore, nectrivore and aquatic invertebrate feeder birds. Some birds also use the area for nesting.

    28
    9998725
    Species Diversity of Migratory Birds along Boat Touring Routes in Klong Kone Sub-District, Muang District, Samut Songkram Province, Thailand
    Abstract:

    This research aims to study the species, feeding behavior and activity characteristics of birds which reap benefits from the research area in boat touring routes in Klong Kone Sub-district, Muang District, Samut Songkram Province, Thailand from October 2013 – May 2014. The results from the survey of birds on all three routes found that there are 11 families and 22 species. Route 1 (Klong Kone canal) had the most species, 20 species. According to feeding behavior, there were insectivorous, piscivorous and aquatic invertebrate feeder birds. Activity characteristics of birds which reap benefits from the research were finding food, nesting and raise nestlings along boat touring routes.

    27
    9998745
    RAPD Analysis of the Genetic Polymorphism in the Collection of Rye Cultivars
    Abstract:

    In the present study, RAPD-PCR was used to assess genetic diversity of the rye including landrances and new rye cultivars coming from Central Europe and the Union of Soviet Socialist Republics (SUN). Five arbitrary random primers were used to determine RAPD polymorphism in the set of 38 rye genotypes. These primers amplified altogether 43 different DNA fragments with an average number of 8.6 fragments per genotypes. The number of fragments ranged from 7 (RLZ 8, RLZ 9 and RLZ 10) to 12 (RLZ 6). DI and PIC values of all RAPD markers were higher than 0.8 that generally means high level of polymorphism detected between rye genotypes. The dendrogram based on hierarchical cluster analysis using UPGMA algorithm was prepared. The cultivars were grouped into two main clusters. In this experiment, RAPD proved to be a rapid, reliable and practicable method for revealing of polymorphism in the rye cultivars.

    26
    9998749
    Fuzzy Optimization in Metabolic Systems
    Abstract:

    The optimization of biological systems, which is a branch of metabolic engineering, has generated a lot of industrial and academic interest for a long time. In the last decade, metabolic engineering approaches based on mathematical optimizations have been used extensively for the analysis and manipulation of metabolic networks. In practical optimization of metabolic reaction networks, designers have to manage the nature of uncertainty resulting from qualitative characters of metabolic reactions, e.g., the possibility of enzyme effects. A deterministic approach does not give an adequate representation for metabolic reaction networks with uncertain characters. Fuzzy optimization formulations can be applied to cope with this problem. A fuzzy multi-objective optimization problem can be introduced for finding the optimal engineering interventions on metabolic network systems considering the resilience phenomenon and cell viability constraints. The accuracy of optimization results depends heavily on the development of essential kinetic models of metabolic networks. Kinetic models can quantitatively capture the experimentally observed regulation data of metabolic systems and are often used to find the optimal manipulation of external inputs. To address the issues of optimizing the regulatory structure of metabolic networks, it is necessary to consider qualitative effects, e.g., the resilience phenomena and cell viability constraints. Combining the qualitative and quantitative descriptions for metabolic networks makes it possible to design a viable strain and accurately predict the maximum possible flux rates of desired products. Considering the resilience phenomena in metabolic networks can improve the predictions of gene intervention and maximum synthesis rates in metabolic engineering. Two case studies will present in the conference to illustrate the phenomena.

    25
    9998790
    DNA Methylation Changes Caused by Lawsone
    Abstract:

    Lawsone is a pigment that occurs naturally in plants. It has been used as a skin and hair dye for a long time. Moreover, its different biological activities have been reported. The present study focused on the effect of lawsone on a plant cell model represented by tobacco BY-2 cell suspension culture, which is used as a model comparable with the HeLa cells. It has been shown that lawsone inhibits the cell growth in the concentration-dependent manner. In addition, changes in DNA methylation level have been determined. We observed decreasing level of DNA methylation in the presence of increasing concentrations of lawsone. These results were accompanied with overproduction of reactive oxygen species (ROS). Since epigenetic modifications can be caused by different stress factors, there could be a connection between the changes in the level of DNA methylation and ROS production caused by lawsone.

    24
    9998811
    Dried Venison Quality Parameters Changes during Storage
    Abstract:

    The aim of the current research was to determine quality parameters changes of dried venison during storage. Protein, fat and moisture content dynamics as well microbiological quality was analyzed. For the experiments the meat (0.02×4.00×7.00 cm) pieces were marinated in “teriyaki sauce” marinade (composition: teriyaki sauce, sweet and sour sauce, taco sauce, soy sauce, American BBQ sauce hickory, sesame oil, garlic, garlic salt, tabasco red pepper sauce) at 4±2°C temperature for 48±1h. Sodium monophosphate (E339) was also added in part of marinade to improve the meat textural properties. After marinating, meat samples were dried in microwave-vacuum drier MUSSON–1, packaged in vacuum pouches made from polymer film (PA/PE) with barrier properties and storage for 4 months at 18±1°C temperature in dark place. Dried venison samples were analyzed after 0, 35, 91 and 112 days of storage. During the storage total plate counts of dried venison samples significantly (p<0.05) increased. No significant differences in the content of protein, fat and moisture were detected when analyzing dried meat samples during storage and comparing them with the chemical parameters of just dried meat.

    23
    9998815
    Qualitative Characteristics of Meat from Lambs Fed Hydrolyzed Sugarcane
    Abstract:

    We used 24 Ile de France lambs, weighing between 15 and 32 kg (BW). Treatments were supplemented with concentrate: “in nature” sugarcane (IN), sugarcane hydrolyzed using 0.6% calcium oxide (CaO) under aerobic condition (AER), and sugarcane hydrolyzed using 0.6% CaO under anaerobic condition (ANA), constituting a completely randomized design with eight repetitions per treatment. Lambs were housed in individual stalls and fed into the through, allowing 10% of leftovers. Lambs were slaughtered when body weight reached 32 kg. The following parameters were determined on Longissimu lumborum muscle of hot and cold carcasses: pH and color, 45 minutes and 24 hours after slaughtering. Qualitative analysis of the meat were performed in the loins, water-holding capacity (WHC), cooking loss (CL), and shear force (SF). We used a completely randomized design with three treatments and eight repetitions. Means were compared by Tukey test at 5% significance. A higher value for redness (a*) 45 minutes after slaughter (10.48) were found for lambs fed hydrolyzed under anaerobic conditions sugarcane. The other qualitative characteristics of meat were not affected by treatments (P >0.05). The comparison of meat quality resulting from the treatments shows that it is possible to feed in nature sugarcane to lambs, thus waiving hydrolyses process and the spending with alkalizing agent.

    22
    9998823
    Field Application of Reduced Crude Conversion Spent Lime
    Abstract:

    Gypsum is being applied to ameliorate subsoil acidity and to overcome the problem of very slow lime movement from surface lime applications. Reduced Crude Conversion Spent Lime (RCCSL) containing anhydrite was evaluated for use as a liming material with specific consideration given to the movement of sulfate into the acid subsoil. Agricultural lime and RCCSL were applied at 0, 0.5, 1.0, and 1.5 times the lime requirement of 6.72 Mg ha-1 to an acid Trappist silt loam (TypicHapuldult). Corn [Zea mays (L.)]was grown following lime material application and soybean [Glycine max (L.) Merr.]was grown in the second year.Soil pH increased rapidly with the addition of the RCCSL material. Over time there was no difference in soil pH between the materials but there was with increasing rate. None of the observed changes in plant nutrient concentration had an impact on yield. Grain yield was higher for the RCCSL amended treatments in the first year but not in the second. There was a significant increase in soybean grain yield from the full lime requirement treatments over no lime.

    21
    9998824
    Effects of Molybdenum on Phosphorus Concentration in Rice (Oryza sativa L.)
    Abstract:

    A hydroponic trial was carried out to investigate the effect of molybdenum (Mo) on uptake of phosphorus (P) in different rice cultivars. The experiment was conducted using a randomized complete-block design, with a split-plot arrangement of treatments and three replications. Four rates of Mo (0, 0.01, 0.1 and 1 mg L−1) and five cultivars (MR219, HASHEMI, MR232, FAJRE and MR253) provided the main and sub-plots, respectively. Interaction of molybdenum×variety was significant on shoot phosphorus uptake (p≤0.01). Highest and lowest shoot phosphorus uptake were seen in Mo3V3 (0.6% plant-1) and Mo0V3 (0.14% plant-1) treatments, respectively. Molybdenum did not have a significant effect on root phosphorus content. According to results, application of molybdenum has a synergistic effect on uptake of phosphorus by rice plants.

    20
    9998826
    Ethnobotanical Survey of Vegetable Plants Traditionally Used in Kalasin Thailand
    Abstract:

    Use of plants grown in local area for edible has a long tradition in different culture. The indigenous knowledge such as usage of plants as vegetables by local people is risk to disappear when no records are done. In order to conserve and transfer this valuable heritage to the new generation, ethnobotanical study should be investigated and documented. The survey of vegetable plants traditionally used was carried out in the year 2012. Information was accumulated via questionnaires and oral interviewing from 100 people living in 36 villages of 9 districts in Amphoe Huai Mek, Kalasin, Thailand. Local plant names, utilized parts and preparation methods of the plants were recorded. Each mentioned plant species were collected and voucher specimens were prepared. A total of 55 vegetable plant species belonging to 34 families and 54 genera were identified. The plant habits were tree, shrub, herb, climber, and shrubby fern at 21.82%, 18.18%, 38.18%, 20.00% and 1.82% respectively. The most encountered vegetable plant families were Leguminosae (20%), Cucurbitaceae (7.27%), Apiaceae (5.45%), whereas families with 3.64% uses were Araceae, Bignoniaceae, Lamiaceae, Passifloraceae, Piperaceae and Solanaceae. The most common consumptions were fresh or brief boiled young shoot or young leaf as side dishes of ‘jaeo, laab, namprik, pon’ or curries. Most locally known vegetables included 45% of the studied plants which grow along road side, backyard garden, hedgerow, open forest and rice field.

    19
    9998827
    An Effect of Organic Supplements on Stimulating Growth of Vanda and Mokara Seedlings in Tissue Culture
    Abstract:

    This study aimed to investigate effect of different organic supplements on growth of Vanda and Mokara seedlings. Vanda and Mokara seedlings approximately 0.2 and 0.3 cm. in height were sub-cultured onto VW supplemented with 150 ml/L coconut water, 100 g/L potato extract, 100 g/L ‘Gros Michel’ banana (AAA group) and 100 g/L ‘Namwa’ banana (ABB group). The explants were sub-cultured onto the same medium every month for 3 months. The best medium increased stem height to 0.52 and 0.44 Cm. in Vanda and Mokara respectively was supplemented with coconut water. The maximum fresh weight of Vanda (0.59 g) was found on medium supplemented with ‘Gros Michel’ banana while Mokara cultured on medium supplemented with Potato extract had the maximum fresh weight (0.27 g) and number of roots (5.20 roots/shoot) statistically different (p≤ 0.05) to other treatments. However, Vanda cultured on medium supplemented with ‘Namwa’ banana had the maximum number of roots (3.80 roots/shoot). Our results suggested that growth of different orchid genera was responded diversely to different organic supplements. 

     

    18
    9998828
    An Effect of Organic Supplements on Stimulating Growth of Dendrobium Protocorms and Seedlings
    Abstract:

    This study was aimed to investigate the effect of various organic supplements on growth and development of Dendrobium discolor’s protocorms and seedlings growth of Dendrobium Judy Rutz. Protocorms of Dendrobium discolor with 2.0 cm. in diameter and seedlings of Dendrobium Judy Rutz at the same size (0.5 cm. height) were sub-cultured on Hyponex medium supplemented with cow milk (CM), soy milk (SM), potato extract (PE) and peptone (P) for 2 months. The protocorms were developed to seedlings in all treatments after cultured for 2 months. However, the best results were found on Hyponex medium supplemented with P was the best in which the maximum fresh and dry weight and maximum shoot height were obtained in this treatment statistically different (p ≤ 0.05) to other treatments. Moreover, Hyponex medium supplemented with P also stimulated the maximum mean number of 5.7 shoots per explant which also showed statistically different (p ≤ 0.05) when compared to other treatments. The results of growth of Dendrobium Judy Rutz seedlings indicated the medium supplemented with 100 mL/L PE enhanced the maximum fresh and dry weigh per explants with significantly different (p ≤ 0.05) in fresh weight from other treatments including the control medium without any organic supplementation. However, the dry weight was not significantly different (p ≤ 0.05) from medium supplemented with SM and P. There was multiple shoots induction in all media with or without organic supplementation ranging from 2.6 to 3 shoots per explants. The maximum shoot height was also obtained in the seedlings cultured on medium supplemented with PE while the longest root length was found in medium supplemented with SM.

    17
    9998829
    Morphological Study of Trichomes in Indigofera wightii Grah. ex Wigh & Arn., Indigo Dye Species, Traditionally Used by “Thaisongdam” Thailand
    Abstract:

    The study aimed to collect morphological data of secretory structures that contribute to taxonomy of Indigofera. Detail features of trichomes occurrence in vegetative and reproductive organs of Indigofera wightii Grah. ex Wigh & Arn., a species traditionally used as source of indigo to dye “Thaisongdam” clothing were investigated. Examination through light microscopy and scanning electrom microscopy were done. Non secretory, T-shaped trichomes appeared throughout surfaces of stems, leaves, flowers and fruits. Secretory or glandular trichomes occurred in two types; one has big cylindrical head and short peduncle, distributed on adaxial surface of sepals and around the pedicel, whereas another possesses smaller cylindrical head but long peduncle. The latter was found on apical surface of immature pods. No phenolic and lipophilic compounds were detected from these glands.

    16
    9998838
    Effects of Maternal Nutrition at Different Stages of Pregnancy in Bali Cows on Growth Performance of the Offspring to Weaning
    Abstract:

    The objective of this study was to investigate the lifelong effect of in utero nutrition fed at different stages of pregnancy in Bali cows (n = 40): (U1) without in utero nutrition (0 – parturition, negative control); (U2) 0 – 90 d of gestation; (U3) 90 - 180 d of gestation; (U4) 180 d – parturition; and (U5) in utero nutrition along gestation period (0 d to parturition – positive control) on the growth performance of the offspring to weaning age. The results indicated that effect of maternal nutrition on male and female offspring were particularly indicated by the growth performance of both the male and female offspring from birth to weaning.

    15
    9998842
    Phytoadaptation in Desert Soil Prediction Using Fuzzy Logic Modeling
    Abstract:

    In terms of ecology forecast effects of desertification, the purpose of this study is to develop a predictive model of growth and adaptation of species in arid environment and bioclimatic conditions. The impact of climate change and the desertification phenomena is the result of combined effects in magnitude and frequency of these phenomena. Like the data involved in the phytopathogenic process and bacteria growth in arid soil occur in an uncertain environment because of their complexity, it becomes necessary to have a suitable methodology for the analysis of these variables. The basic principles of fuzzy logic those are perfectly suited to this process. As input variables, we consider the physical parameters, soil type, bacteria nature, and plant species concerned. The result output variable is the adaptability of the species expressed by the growth rate or extinction. As a conclusion, we prevent the possible strategies for adaptation, with or without shifting areas of plantation and nature adequate vegetation.

    14
    9998843
    Phytopathology Prediction in Dry Soil Using Artificial Neural Networks Modeling
    Abstract:

    The rapid expansion of deserts in recent decades as a result of human actions combined with climatic changes has highlighted the necessity to understand biological processes in arid environments. Whereas physical processes and the biology of flora and fauna have been relatively well studied in marginally used arid areas, knowledge of desert soil micro-organisms remains fragmentary. The objective of this study is to conduct a diversity analysis of bacterial communities in unvegetated arid soils. Several biological phenomena in hot deserts related to microbial populations and the potential use of micro-organisms for restoring hot desert environments. Dry land ecosystems have a highly heterogeneous distribution of resources, with greater nutrient concentrations and microbial densities occurring in vegetated than in bare soils. In this work, we found it useful to use techniques of artificial intelligence in their treatment especially artificial neural networks (ANN). The use of the ANN model, demonstrate his capability for addressing the complex problems of uncertainty data.

    13
    9998859
    Evaluating the Sustainability of Agricultural by Indicator that Appropriate to the Area of Ban Phaeo District, Samut Sakorn Province, Thailand
    Abstract:

    The objectives of the research are to study the existing agricultural patterns, and to evaluate the sustainability of agricultural on economic, social and environmental aspects. The samplings were the representatives of the agriculturist group from Ban Paew district, Samut Sakorn province by purposive sampling method of 30 households. The tools being used were interview forms together with the Rapid Rural Appraisal (RRA) and the Participation Rural Appraisal (PRA). The information collected was analyzed with the principle of Content Analysis andusing Descriptive Statistics. After that all the information gotten was analyze the sustainability on the household level and village level. The research result can be concluded as follows: The agricultural Patterns: For most of the cultivation main crop was fruit trees planted and the supplement crop was around the patch or added other plants in the trenches. There were trenches for the cultivating water. The product distribution was by selling (97.5%) and the selling to middle man was the highest number (62.5%). Evaluating the sustainability of the agricultural by the indicators which were appropriate to the area: For the agricultural sustainability on the household level it was found that only one household had sustainable, others household had conditioned sustainable. For on the village level it was found that the sustainability on the issue of agricultural knowledge training had the lowest level (Sustainability index = 31.67%). Secondary was the acknowledging about soil information (Sustainability index = 35.0), and the household labors on agriculture, net return over cash cost (Sustainability index = 55.0%) respectively. Performance percentage is 48.81 %. It was brought to the conclusion that this area did not have the agricultural sustainability.

    12
    9998862
    The Effect of Electric Field Distributions on Grains and Insect for Dielectric Heating Applications
    Abstract:

    This paper presents the effect of electric field distribution which is an electric field intensity analysis. Consideration of the dielectric heating of grains and insects, the rice and rice weevils are utilized for dielectric heating analysis. Furthermore, this analysis compares the effect of electric field distribution in rice and rice weevil. In this simulation, two copper plates are used to generate the electric field for dielectric heating system and put the rice materials between the copper plates. The simulation is classified in two cases, which are case I one rice weevil is placed in the rice and case II two rice weevils are placed at different position in the rice. Moreover, the probes are located in various different positions on plate. The power feeding on this plate is optimized by using CST EM studio program of 1000 watt electrical power at 39 MHz resonance frequency. The results of two cases are indicated that the most electric field distribution and intensity are occurred on the rice and rice weevils at the near point of the probes. Moreover, the heat is directed to the rice weevils more than the rice. When the temperature of rice and rice weevils are calculated and compared, the rice weevils has the temperature more than rice is about 41.62 Celsius degrees. These results can be applied for the dielectric heating applications to eliminate insect.

    11
    9998864
    Protective Effect of Hesperidin against Cyclophosphamide Hepatotoxicity in Rats
    Abstract:

    The protective effect of hesperidin was investigated in rats exposed to liver injury induced by a single intraperitoneal injection of cyclophosphamide (CYP) at a dose of 150 mg kg-1. Hesperidin treatment (100 mg kg-1/day, orally) was applied for seven days, starting five days before CYP administration. Hesperidin significantly decreased the CYP-induced elevations of serum alanine aminotransferase, and hepatic malondialdehyde and myeloperoxidase activity, significantly prevented the depletion of hepatic glutathione peroxidase activity resulted from CYP administration. Also, hesperidin ameliorated the CYP-induced liver tissue injury observed by histopathological examination. In addition, hesperidin decreased the CYP-induced expression of inducible nitric oxide synthase, tumor necrosis factor-α, cyclooxygenase-2, Fas ligand, and caspase-9 in liver tissue. It was concluded that hesperidin may represent a potential candidate to protect against CYP-induced hepatotoxicity.

    10
    9998901
    Serological IgG Testing to Diagnose Alimentary Induced Diseases and Monitoring Efficacy of an Individual Defined Diet in Dogs
    Abstract:

    Background. Food-related allergies and intolerances are frequently occurring in dogs. Diagnosis and monitoring according ‘Golden Standard’ of elimination efficiency is, however, time consuming, expensive, and requires expert clinical setting. In order to facilitate rapid and robust, quantitative testing of intolerance, and determining the individual offending foods, a serological test is implicated for Alimentary Induced Diseases and manifestations. Method. As we developed Medisynx IgG Human Screening Test ELISA before and the dog’ immune system is most similar to humans, we were able to develop Medisynx IgG Dog Screening Test ELISA as well. In this randomized, double-blind, split-sample, retro perspective study 47 dogs suffering from Canine Atopic Dermatitis (CAD) and several secondary induced reactions were included to participate in serological Medisynx IgG Dog Screening Test ELISA (within < 0,02 % SD). Results were expressed as titers relative to the standard OD readings to diagnose alimentary induced diseases and monitoring efficacy of an individual eliminating diet in dogs. Split sample analysis was performed by independently sending 2 times 3 ml serum under two unique codes. Results. The veterinarian monitored these dogs to check dog’ results at least at 3, 7, 21, 49, 70 days and after period of 6 and 12 months on an individual negative diet and a positive challenge (retrospectively) at 6 months. Data of each dog were recorded in a screening form and reported that a complete recovery of all clinical manifestations was observed at or less than 70 days (between 50 and 70 days) in the majority of dogs (44 out of 47 dogs =93.6%). Conclusion. Challenge results showed a significant result of 100% in specificity as well as 100% positive predicted value. On the other hand, sensitivity was 95,7% and negative predictive value was 95,7%. In conclusion, an individual diet based on IgG ELISA in dogs provides a significant improvement of atopic dermatitis and pruritus including all other non-specific defined allergic skin reactions as erythema, itching, biting and gnawing at toes, as well as to several secondary manifestations like chronic diarrhoea, chronic constipation, otitis media, obesity, laziness or inactive behaviour, pain and muscular stiffness causing a movement disorders, excessive lacrimation, hyper behaviour, nervous behaviour and not possible to stay alone at home, anxiety, biting and aggressive behaviour and disobedience behaviour. Furthermore, we conclude that a relatively more severe systemic candidiasis, as shown by relatively higher titer (class 3 and 4 IgG reactions to Candida albicans), influence the duration of recovery from clinical manifestations in affected dogs. These findings are consistent with our preliminary human clinical studies.

    9
    9998938
    Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa
    Abstract:

    Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

    8
    9999034
    Effects of Varying Air Temperature in the Polishing Component of Single-Pass Mill on the Quality of Rice
    Abstract:

    The effects of varying air temperature (full, ¾ full, ½ full aircon adjustment, no aircon) in polishing component of Single-Pass Mill on the quality of Philippine inbred rice variety, was investigated. Parameters measured were milling recovery (MR), headrice recovery (HR), and percentage with bran streaks. Cooling method (with aircon) increased MR, HR, and percentage with bran streaks of milled rice. Highest MR and HR (67.62%; 47.33%) were obtained from ¾ full adjustment whereas no aircon were lowest (66.27%; 39.76%). Temperature in polishing component at ¾ full adjustment was 33oC whereas no aircon was 45oC. There was increase of 1.35% in MR and 7.57% in HR. Additional cost of milling per kg due to aircon cooling was P0.04 at 300 tons/yr volume, with 0.15 yr payback period. Net income was estimated at ₱98,100.00. Percentage of kernels with bran streaks increased from 5%–14%, indicating more nutrients of milled rice.

    7
    9999577
    The Co-application of Plant Growth Promoting Rhizobacteria and Inoculation with Rhizobium Bacteria on Grain Yield and Its Components of Mungbean (Vigna radiate L.) in Ilam Province, Iran
    Abstract:

    In order to investigate the effect of Plant Growth Promoting Rhizobacteria (PGPR) and rhizobium bacteria on grain yield and some agronomic traits of mungbean (Vigna radiate L.), an experiment was carried out based on randomized complete block design with three replications in Malekshahi, Ilam province, Iran during 2012-2013 cropping season. Experimental treatments consisted of control treatment, inoculation with rhizobium bacteria, rhizobium bacteria and Azotobacter, rhizobium bacteria and Azospirillum, rhizobium bacteria and Pseudomonas, rhizobium bacteria, Azotobacter and Azospirillum, rhizobium bacteria, Azotobacter and Pseudomonas, rhizobium bacteria, Azospirillum and Pseudomonas and rhizobium bacteria, Azotobacter, Azospirillum and Pseudomonas. The results showed that the effect of PGPR and rhizobium bacteria were significant affect on grain and its components in mungbean plant. Grain yield significantly increased by PGPR and rhizobium bacteria, so that the maximum grain yield was obtained from rhizobium bacteria + Azospirillum + Pseudomonas with the amount of 2287 kg.ha-1 as compared to control treatment. Excessive application of chemical fertilizers causes environmental and economic problems. That is, the overfertilization of P and N leads to pollution due to soil erosion and runoff water, so the use of PGPR and rhizobium bacteria can be justified due to reduce input costs, increase in grain yield and environmental friendly.

    6
    9999578
    Heritability and Repeatability Estimates of Some Measurable Traits in Meat Type Chickens Reared for Ten Weeks in Abeokuta, Nigeria
    Abstract:

    A total of 150 meat type chickens comprising 50 each of Arbor Acre, Marshall and Ross were used for this study which lasted for 10 weeks at the Federal University of Agriculture, Abeokuta, Nigeria. Growth performance data were collected from the third week through week 10 and data obtained were analysed using the Generalized Linear Model Procedure. Heritability estimates (h2) for body dimensions carried out on the chicken strains ranged from low to high. Marshall broiler chicken strain had the highest h2 for body weight 0.46±0.04, followed by Arbor Acre and Ross with h2 being 0.38±0.12 and 0.26±0.06, respectively. The repeatability estimates for body weight in the three broiler strains were high, and it ranged from 0.70 at week 4 to 0.88 at week 10. Relationships between the body weight and linear body measurements in the broiler chicken strains were positive and highly significant (p > 0.05).

    5
    9999852
    Influence of Probiotics on Dairy Cows Diet
    Abstract:

    The main goal of this paper was evaluate the effect of diets containing different levels of probiotic on performance and milk composition of lactating cows. Eight Holstein cows were distributed in two 4x4 Latin square. The diets were based on corn silage, concentrate and the treatment (0, 3, 6 or 9 grams of probiotic/animal/day). It was evaluated the dry matter intake of nutrients, milk yield and composition. The use of probiotics did not affect the nutrient intake (p>0.05) neither the daily milk production or corrected to 4% fat (p>0.05). However, it was observed that there was a significant fall in milk composition with higher levels of probiotics supplementation. These results emphasize the need of further studies with different experimental designs or improve the number of Latin square with longer periods of adaptation.

    4
    10001086
    Various Advanced Statistical Analyses of Index Values Extracted from Outdoor Agricultural Workers Motion Data
    Abstract:

    We have been grouping and developing various kinds of practical, promising sensing applied systems concerning agricultural advancement and technical tradition (guidance). These include advanced devices to secure real-time data related to worker motion, and we analyze by methods of various advanced statistics and human dynamics (e.g. primary component analysis, Ward system based cluster analysis, and mapping). What is more, we have been considering worker daily health and safety issues. Targeted fields are mainly common farms, meadows, and gardens. After then, we observed and discussed time-line style, changing data. And, we made some suggestions. The entire plan makes it possible to improve both the aforementioned applied systems and farms.

    3
    10002288
    Effect of Calving Season on the Economic and Production Efficiency of Dairy Production Breeds
    Abstract:
    The objective of this study was to evaluate the effects of calving season on the production and economic efficiency of dairy farms in Egypt. Our study was performed at dairy production farms in the Alexandria, Behera, and Kafr El-Sheikh provinces of Egypt from summer 2010 to winter 2013. The randomly selected dairy farms had herds consisting of Baladi, Holstein-Friesian, or cross-bred (Baladi × Holstein-Friesian) cows. The data were collected from production records and responses to a structured questionnaire. The average total return differed significantly (P < 0.05) between the different cattle breeds and calving seasons. The average total return was highest for the Holstein- Friesian cows that calved in the winter (29106.42 EGP/cow/year), and it was lowest for Baladi cows that calved in the summer (12489.79 EGP/cow/year). Differences in total returns between the cows that calved in the winter or summer or between the foreign and native breeds, as well as variations in calf prices, might have contributed to the differences in milk yield. The average net profit per cow differed significantly (P < 0.05) between the cattle breeds and calving seasons. The average net profit values for the Baladi cows that calved in the winter or summer were 2413 and 2994.96 EGP/cow/year, respectively, and those for the Holstein- Friesian cows were 10744.17 and 7860.56 EGP/cow/year, respectively, whereas those for the cross-bred cows were 10174.86 and 7571.33 EGP/cow/year, respectively. The variations in net profit might have resulted from variation in the availability or price of feed materials, milk prices, or sales volumes. Our results show that the breed and calving season of dairy cows significantly affected the economic efficiency of dairy farms in Egypt. The cows that calved in the winter produced more milk than those that calved in the summer, which may have been the result of seasonal influences, such as temperature, humidity, management practices, and the type of feed or green fodder available.
    Keywords:
    2
    10002648
    Biologically Active Caffeic Acid-Derived Biopolymer
    Abstract:

    The high-molecular water-soluble preparations from several species of two genera (Symphytum and Anchusa) of Boraginaceae family Symphytum asperum, S. caucasicum, S.officinale and Anchusa italica were isolated. According to IR, 13C and 1H NMR, APT, 1D NOE, 2D heteronuclear 1H/13C HSQC and 2D DOSY experiments, the main chemical constituent of these preparations was found to be caffeic acid-derived polyether, namely poly[3-(3,4-dihydroxyphenyl)glyceric acid] (PDPGA) or poly[oxy-1- carboxy-2-(3,4-dihydroxyphenyl)ethylene]. Most carboxylic groups of this caffeic acid-derived polymer of A. italica are methylated.

    1
    10003555
    Protein Quality of Game Meat Hunted in Latvia
    Abstract:
    Not all proteins have the same nutritional value, since protein quality strongly depends on its amino acid composition and digestibility. The meat of game animals could be a high protein source because of its well-balanced essential amino acids composition. Investigations about biochemical composition of game meat such as wild boar (Sus scrofa scrofa), roe deer (Capreolus capreolus) and beaver (Castor fiber) are not very much. Therefore, the aim of the investigation was evaluate protein composition of game meat hunted in Latvia. The biochemical analysis, evaluation of connective tissue and essential amino acids in meat samples were done, the amino acids score were calculate. Results of analysis showed that protein content 20.88-22.05% of all types of meat samples is not different statistically. The content of connective tissue from 1.3% in roe deer till 1.5% in beaver meat allowed classified game animal as high quality meat. The sum of essential amino acids in game meat samples were determined 7.05–8.26g100g-1. Roe deer meat has highest protein content and lowest content of connective tissues among game meat hunted in Latvia. Concluded that amino acid score for limiting amino acids phenylalanine and tyrosine is high and shows high biological value of game meat.